Beopenlab

MLEC siRNA
20-abx903276	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MLEC siRNA
20-abx924228	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MLEC siRNA
20-abx924229	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-MLEC
PVT18389	Lifescience Market	2 ug	EUR 231

MLEC cloning plasmid
CSB-CL014620HU-10ug	Cusabio	10ug	EUR 356
Formulation: 10 μg plasmid + 200μl Glycerol Length: 879 Sequence: atgctgggagcctgggcggttgagggaaccgctgtggcgctcctgcgactgctgctgctgctgctgccgccggcgatccggggacccgggctcggcgtggccggcgtggccggcgcggcgggggccgggctgcccgagagcgtcatttgggcggtcaacgcgggtggagaggcgca Show more
Description: A cloning plasmid for the MLEC gene.

Malectin (MLEC) Antibody
20-abx100273	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Malectin (MLEC) Protein
20-abx262673	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Recombinant Malectin (MLEC)
4-RPM908Ga01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q98TA4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.6kDa Isoelectric Point: Inquire
Description: Recombinant Chicken Malectin expressed in: E.coli

Mouse MLEC shRNA Plasmid
20-abx979976	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat MLEC shRNA Plasmid
20-abx989275	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Chicken Malectin (MLEC) Protein
20-abx067920	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Malectin (MLEC) Antibody (FITC)
20-abx273549	Abbexa	EUR 509.00 EUR 258.00 EUR 1525.00 EUR 704.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Malectin (MLEC) Antibody (Biotin)
20-abx271704	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human MLEC shRNA Plasmid
20-abx956526	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MLEC protein (His tag)
80R-2934	Fitzgerald	50 ug	EUR 435
Description: Purified recombinant LIMD2 protein (His tag)

MLEC Recombinant Protein (Human)
RP019552	ABM	100 ug	Ask for price

MLEC Recombinant Protein (Rat)
RP211850	ABM	100 ug	Ask for price

MLEC Recombinant Protein (Mouse)
RP150794	ABM	100 ug	Ask for price

Human Malectin, MLEC ELISA KIT
ELI-19494h	Lifescience Market	96 Tests	EUR 824

Mouse Malectin, Mlec ELISA KIT
ELI-16534m	Lifescience Market	96 Tests	EUR 865

MLEC ORF Vector (Human) (pORF)
ORF006518	ABM	1.0 ug DNA	EUR 95

Malectin (MLEC) Polyclonal Antibody (Chicken)
4-PAM908Ga01	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MLEC (Leu22~Leu254) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC)

Mlec ORF Vector (Mouse) (pORF)
ORF050266	ABM	1.0 ug DNA	EUR 506

Mlec ORF Vector (Rat) (pORF)
ORF070618	ABM	1.0 ug DNA	EUR 506

Human Malectin(MLEC)ELISA Kit
QY-E04811	Qayee Biotechnology	96T	EUR 361

MLEC Malectin Human Recombinant Protein
PROTQ14165	BosterBio	Regular: 10ug	EUR 317
Description: MLEC Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 264 amino acids (29-269) and having a molecular mass of 29.1kDa.

MLEC sgRNA CRISPR Lentivector set (Human)
K1307201	ABM	3 x 1.0 ug	EUR 339

Mlec sgRNA CRISPR Lentivector set (Mouse)
K4531201	ABM	3 x 1.0 ug	EUR 339

ELISA kit for Rat Malectin (MLEC)
KTE100609-48T	Abbkine	48T	EUR 332
MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic Show more
Description: Quantitative sandwich ELISA for measuring Rat Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Malectin (MLEC)
KTE100609-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic Show more
Description: Quantitative sandwich ELISA for measuring Rat Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Malectin (MLEC)
KTE100609-96T	Abbkine	96T	EUR 539
MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic Show more
Description: Quantitative sandwich ELISA for measuring Rat Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mlec sgRNA CRISPR Lentivector set (Rat)
K7294101	ABM	3 x 1.0 ug	EUR 339

Malectin (MLEC) Polyclonal Antibody (Chicken), APC
4-PAM908Ga01-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MLEC (Leu22~Leu254) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with APC.

Malectin (MLEC) Polyclonal Antibody (Chicken), Biotinylated
4-PAM908Ga01-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MLEC (Leu22~Leu254) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with Biotin.

Malectin (MLEC) Polyclonal Antibody (Chicken), Cy3
4-PAM908Ga01-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MLEC (Leu22~Leu254) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with Cy3.

Malectin (MLEC) Polyclonal Antibody (Chicken), FITC
4-PAM908Ga01-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MLEC (Leu22~Leu254) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with FITC.

Malectin (MLEC) Polyclonal Antibody (Chicken), HRP
4-PAM908Ga01-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MLEC (Leu22~Leu254) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with HRP.

Malectin (MLEC) Polyclonal Antibody (Chicken), PE
4-PAM908Ga01-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MLEC (Leu22~Leu254) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with PE.

ELISA kit for Human Malectin (MLEC)
KTE61601-48T	Abbkine	48T	EUR 332
MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. Malectin has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic ret Show more
Description: Quantitative sandwich ELISA for measuring Human Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Malectin (MLEC)
KTE61601-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. Malectin has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic ret Show more
Description: Quantitative sandwich ELISA for measuring Human Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Malectin (MLEC)
KTE61601-96T	Abbkine	96T	EUR 539
MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. Malectin has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic ret Show more
Description: Quantitative sandwich ELISA for measuring Human Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Malectin (MLEC)
KTE71013-48T	Abbkine	48T	EUR 332
MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic Show more
Description: Quantitative sandwich ELISA for measuring Mouse Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Malectin (MLEC)
KTE71013-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic Show more
Description: Quantitative sandwich ELISA for measuring Mouse Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Malectin (MLEC)
KTE71013-96T	Abbkine	96T	EUR 539
MLEC encodes the carbohydrate-binding protein malectin which is a Type I membrane-anchored endoplasmic reticulum protein. This protein has an affinity for Glc2Man9GlcNAc2 (G2M9) N-glycans and is involved in regulating glycosylation in the endoplasmic Show more
Description: Quantitative sandwich ELISA for measuring Mouse Malectin (MLEC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MLEC sgRNA CRISPR Lentivector (Human) (Target 1)
K1307202	ABM	1.0 ug DNA	EUR 154

MLEC sgRNA CRISPR Lentivector (Human) (Target 2)
K1307203	ABM	1.0 ug DNA	EUR 154

MLEC sgRNA CRISPR Lentivector (Human) (Target 3)
K1307204	ABM	1.0 ug DNA	EUR 154

Mlec sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4531202	ABM	1.0 ug DNA	EUR 154

Mlec sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4531203	ABM	1.0 ug DNA	EUR 154

Mlec sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4531204	ABM	1.0 ug DNA	EUR 154

Mlec sgRNA CRISPR Lentivector (Rat) (Target 1)
K7294102	ABM	1.0 ug DNA	EUR 154

Mlec sgRNA CRISPR Lentivector (Rat) (Target 2)
K7294103	ABM	1.0 ug DNA	EUR 154

Mlec sgRNA CRISPR Lentivector (Rat) (Target 3)
K7294104	ABM	1.0 ug DNA	EUR 154

Malectin (MLEC) Polyclonal Antibody (Chicken), APC-Cy7
4-PAM908Ga01-APC-Cy7	Cloud-Clone	EUR 657.00 EUR 7654.00 EUR 2011.00 EUR 882.00 EUR 355.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MLEC (Leu22~Leu254) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Malectin (MLEC). This antibody is labeled with APC-Cy7.

Recombinant Human MLEC Protein, His, E.coli-10ug
QP12700-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human MLEC Protein, His, E.coli-1mg
QP12700-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Human MLEC Protein, His, E.coli-2ug
QP12700-2ug	EnQuireBio	2ug	EUR 155

MLEC Protein Vector (Rat) (pPB-C-His)
PV282470	ABM	500 ng	EUR 603

MLEC Protein Vector (Rat) (pPB-N-His)
PV282471	ABM	500 ng	EUR 603

MLEC Protein Vector (Rat) (pPM-C-HA)
PV282472	ABM	500 ng	EUR 603

MLEC Protein Vector (Rat) (pPM-C-His)
PV282473	ABM	500 ng	EUR 603

MLEC Protein Vector (Human) (pPB-C-His)
PV026069	ABM	500 ng	EUR 329

MLEC Protein Vector (Human) (pPB-N-His)
PV026070	ABM	500 ng	EUR 329

MLEC Protein Vector (Human) (pPM-C-HA)
PV026071	ABM	500 ng	EUR 329

MLEC Protein Vector (Human) (pPM-C-His)
PV026072	ABM	500 ng	EUR 329

MLEC Protein Vector (Mouse) (pPB-C-His)
PV201062	ABM	500 ng	EUR 603

MLEC Protein Vector (Mouse) (pPB-N-His)
PV201063	ABM	500 ng	EUR 603

MLEC Protein Vector (Mouse) (pPM-C-HA)
PV201064	ABM	500 ng	EUR 603

MLEC Protein Vector (Mouse) (pPM-C-His)
PV201065	ABM	500 ng	EUR 603

Mlec 3'UTR GFP Stable Cell Line
TU163236	ABM	1.0 ml	Ask for price

Mlec 3'UTR Luciferase Stable Cell Line
TU213227	ABM	1.0 ml	Ask for price

MLEC 3'UTR Luciferase Stable Cell Line
TU014344	ABM	1.0 ml	EUR 4617

Mlec 3'UTR Luciferase Stable Cell Line
TU113236	ABM	1.0 ml	Ask for price

MLEC 3'UTR GFP Stable Cell Line
TU064344	ABM	1.0 ml	EUR 4617

Mlec 3'UTR GFP Stable Cell Line
TU263227	ABM	1.0 ml	Ask for price

MLEC Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV657643	ABM	1.0 ug DNA	EUR 514

MLEC Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV657647	ABM	1.0 ug DNA	EUR 514

MLEC Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV657648	ABM	1.0 ug DNA	EUR 514

MLEC sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1307205	ABM	3 x 1.0 ug	EUR 376

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4531205	ABM	3 x 1.0 ug	EUR 376

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7294105	ABM	3 x 1.0 ug	EUR 376

MLEC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1307206	ABM	1.0 ug DNA	EUR 167

MLEC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1307207	ABM	1.0 ug DNA	EUR 167

MLEC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1307208	ABM	1.0 ug DNA	EUR 167

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4531206	ABM	1.0 ug DNA	EUR 167

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4531207	ABM	1.0 ug DNA	EUR 167

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4531208	ABM	1.0 ug DNA	EUR 167

MLEC Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV657644	ABM	1.0 ug DNA	EUR 514

MLEC Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV657645	ABM	1.0 ug DNA	EUR 572

MLEC Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV657646	ABM	1.0 ug DNA	EUR 572

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7294106	ABM	1.0 ug DNA	EUR 167

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7294107	ABM	1.0 ug DNA	EUR 167

Mlec sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7294108	ABM	1.0 ug DNA	EUR 167