MGAT4A Antibody

40012-100ul 100ul
EUR 390

MGAT4A siRNA

20-abx903242
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MGAT4A siRNA

20-abx924087
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MGAT4A siRNA

20-abx924088
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MGAT4A Polyclonal Antibody

28950-100ul 100ul
EUR 252

MGAT4A Polyclonal Antibody

28950-50ul 50ul
EUR 187

MGAT4A Rabbit pAb

A15401-100ul 100 ul
EUR 308

MGAT4A Rabbit pAb

A15401-200ul 200 ul
EUR 459

MGAT4A Rabbit pAb

A15401-20ul 20 ul
EUR 183

MGAT4A Rabbit pAb

A15401-50ul 50 ul
EUR 223

MGAT4A cloning plasmid

CSB-CL890937HU-10ug 10ug
EUR 560
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1608
  • Sequence: ATGAGGCTCCGCAATGGAACTGTAGCCACTGCTTTAGCATTTATCACTTCCTTCCTTACTTTGTCTTGGTATACTACATGGCAAAATGGGAAAGAAAAACTGATTGCTTATCAACGAGAATTCCTTGCTTTGAAAGAACGTCTTCGAATAGCTGAACACAGAATCTCACAGCGCT
  • Show more
Description: A cloning plasmid for the MGAT4A gene.

anti- MGAT4A antibody

FNab05159 100µg
EUR 585
  • Immunogen: mannosyl(alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
  • Uniprot ID: Q9UM21
  • Gene ID: 11320
  • Research Area: Metabolism
Description: Antibody raised against MGAT4A

Anti-MGAT4A antibody

PAab05159 100 ug
EUR 412

Anti-MGAT4A antibody

STJ117596 100 µl
EUR 277
Description: This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme B, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1, 4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation.

Anti-MGAT4A (4H4)

YF-MA11360 100 ug
EUR 363
Description: Mouse monoclonal to MGAT4A

Anti-MGAT4A (8C5)

YF-MA17714 100 ug
EUR 363
Description: Mouse monoclonal to MGAT4A

Bovine MGAT4A ELISA KIT

ELI-14025b 96 Tests
EUR 928

Mouse Mgat4a ELISA KIT

ELI-16292m 96 Tests
EUR 865

Chicken MGAT4A ELISA KIT

ELI-23422c 96 Tests
EUR 928

MGAT4A ELISA KIT|Human

EF000774 96 Tests
EUR 689

Rat MGAT4A shRNA Plasmid

20-abx990688
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MGAT4A Polyclonal Conjugated Antibody

C28950 100ul
EUR 397

Human MGAT4A shRNA Plasmid

20-abx957750
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MGAT4A shRNA Plasmid

20-abx983021
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MGAT4A ELISA KIT

ELI-37176h 96 Tests
EUR 824

MGAT4A Recombinant Protein (Human)

RP041320 100 ug Ask for price

MGAT4A Recombinant Protein (Mouse)

RP150506 100 ug Ask for price

MGAT4A Recombinant Protein (Rat)

RP211577 100 ug Ask for price

MGAT4A Recombinant Protein (Rat)

RP211580 100 ug Ask for price

Polyclonal MGAT4A Antibody (N-Term)

APR08428G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MGAT4A (N-Term). This antibody is tested and proven to work in the following applications:

Mgat4a ORF Vector (Rat) (pORF)

ORF070527 1.0 ug DNA
EUR 506

Mgat4a ORF Vector (Rat) (pORF)

ORF070528 1.0 ug DNA
EUR 506

MGAT4A ORF Vector (Human) (pORF)

ORF013774 1.0 ug DNA
EUR 354

Mgat4a ORF Vector (Mouse) (pORF)

ORF050170 1.0 ug DNA
EUR 506

Mgat4a sgRNA CRISPR Lentivector set (Rat)

K6737501 3 x 1.0 ug
EUR 339

MGAT4A sgRNA CRISPR Lentivector set (Human)

K1298401 3 x 1.0 ug
EUR 339

Mgat4a sgRNA CRISPR Lentivector set (Mouse)

K3342901 3 x 1.0 ug
EUR 339

Monoclonal MGAT4A Antibody (monoclonal) (M01), Clone: 8C5

APR08426G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MGAT4A (monoclonal) (M01). The antibodies are raised in mouse and are from clone 8C5. This antibody is applicable in WB

Monoclonal MGAT4A Antibody (monoclonal) (M02), Clone: 4H4

APR08427G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MGAT4A (monoclonal) (M02). The antibodies are raised in mouse and are from clone 4H4. This antibody is applicable in WB and IHC, E

Mgat4a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6737502 1.0 ug DNA
EUR 154

Mgat4a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6737503 1.0 ug DNA
EUR 154

Mgat4a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6737504 1.0 ug DNA
EUR 154

MGAT4A sgRNA CRISPR Lentivector (Human) (Target 1)

K1298402 1.0 ug DNA
EUR 154

MGAT4A sgRNA CRISPR Lentivector (Human) (Target 2)

K1298403 1.0 ug DNA
EUR 154

MGAT4A sgRNA CRISPR Lentivector (Human) (Target 3)

K1298404 1.0 ug DNA
EUR 154

Mgat4a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3342902 1.0 ug DNA
EUR 154

Mgat4a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3342903 1.0 ug DNA
EUR 154

Mgat4a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3342904 1.0 ug DNA
EUR 154

MGAT4A Protein Vector (Mouse) (pPB-C-His)

PV200678 500 ng
EUR 603

MGAT4A Protein Vector (Mouse) (pPB-N-His)

PV200679 500 ng
EUR 603

MGAT4A Protein Vector (Mouse) (pPM-C-HA)

PV200680 500 ng
EUR 603

MGAT4A Protein Vector (Mouse) (pPM-C-His)

PV200681 500 ng
EUR 603

MGAT4A Protein Vector (Rat) (pPB-C-His)

PV282106 500 ng
EUR 603

MGAT4A Protein Vector (Rat) (pPB-N-His)

PV282107 500 ng
EUR 603

MGAT4A Protein Vector (Rat) (pPM-C-HA)

PV282108 500 ng
EUR 603

MGAT4A Protein Vector (Rat) (pPM-C-His)

PV282109 500 ng
EUR 603

MGAT4A Protein Vector (Rat) (pPB-C-His)

PV282110 500 ng
EUR 603

MGAT4A Protein Vector (Rat) (pPB-N-His)

PV282111 500 ng
EUR 603

MGAT4A Protein Vector (Rat) (pPM-C-HA)

PV282112 500 ng
EUR 603

MGAT4A Protein Vector (Rat) (pPM-C-His)

PV282113 500 ng
EUR 603

MGAT4A Protein Vector (Human) (pPB-C-His)

PV055093 500 ng
EUR 481

MGAT4A Protein Vector (Human) (pPB-N-His)

PV055094 500 ng
EUR 481

MGAT4A Protein Vector (Human) (pPM-C-HA)

PV055095 500 ng
EUR 481

MGAT4A Protein Vector (Human) (pPM-C-His)

PV055096 500 ng
EUR 481

Mgat4a 3'UTR Luciferase Stable Cell Line

TU113169 1.0 ml Ask for price

Mgat4a 3'UTR GFP Stable Cell Line

TU163169 1.0 ml Ask for price

Mgat4a 3'UTR Luciferase Stable Cell Line

TU213131 1.0 ml Ask for price

Mgat4a 3'UTR GFP Stable Cell Line

TU263131 1.0 ml Ask for price

MGAT4A 3'UTR GFP Stable Cell Line

TU063317 1.0 ml
EUR 4617

MGAT4A 3'UTR Luciferase Stable Cell Line

TU013317 1.0 ml
EUR 4617

MGAT4A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV656341 1.0 ug DNA
EUR 682

MGAT4A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV656345 1.0 ug DNA
EUR 682

MGAT4A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV656346 1.0 ug DNA
EUR 682

MGAT4A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV656353 1.0 ug DNA
EUR 682

MGAT4A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV656357 1.0 ug DNA
EUR 682

MGAT4A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV656358 1.0 ug DNA
EUR 682

Mgat4a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6737505 3 x 1.0 ug
EUR 376

MGAT4A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1298405 3 x 1.0 ug
EUR 376

Mgat4a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3342905 3 x 1.0 ug
EUR 376

Mgat4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6737506 1.0 ug DNA
EUR 167

Mgat4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6737507 1.0 ug DNA
EUR 167

Mgat4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6737508 1.0 ug DNA
EUR 167

MGAT4A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV656342 1.0 ug DNA
EUR 682

MGAT4A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV656343 1.0 ug DNA
EUR 740

MGAT4A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV656344 1.0 ug DNA
EUR 740

MGAT4A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV656354 1.0 ug DNA
EUR 682

MGAT4A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV656355 1.0 ug DNA
EUR 740

MGAT4A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV656356 1.0 ug DNA
EUR 740

MGAT4A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1298406 1.0 ug DNA
EUR 167

MGAT4A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1298407 1.0 ug DNA
EUR 167

MGAT4A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1298408 1.0 ug DNA
EUR 167

Mgat4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3342906 1.0 ug DNA
EUR 167

Mgat4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3342907 1.0 ug DNA
EUR 167

Mgat4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3342908 1.0 ug DNA
EUR 167

Mannosyl (Alpha-1,3-)-Glycoprotein Beta-1,4-N-Acetylglucosaminyltransferase, Isozyme A (MGAT4A) Antibody

abx037290-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.