LYPD6B siRNA

20-abx923183
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LYPD6B cloning plasmid

CSB-CL822823HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atgctgctcctctgtcacgctctcgctatagctgttgtccagatcgttatcttctcagaaagctgggcatttgccaagaacatcaacttctataatgtgaggcctcctctcgaccctacaccatttccaaatagcttcaagtgctttacttgtgaaaacgcaggggataattataa
  • Show more
Description: A cloning plasmid for the LYPD6B gene.

Mouse LYPD6B shRNA Plasmid

20-abx977568
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LYPD6B shRNA Plasmid

20-abx965037
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LYPD6B Recombinant Protein (Human)

RP018475 100 ug Ask for price

LYPD6B Recombinant Protein (Rat)

RP210422 100 ug Ask for price

LYPD6B Recombinant Protein (Mouse)

RP148775 100 ug Ask for price

LYPD6B ORF Vector (Human) (pORF)

ORF006159 1.0 ug DNA
EUR 95

Lypd6b ORF Vector (Mouse) (pORF)

ORF049593 1.0 ug DNA
EUR 506

Lypd6b ORF Vector (Rat) (pORF)

ORF070142 1.0 ug DNA
EUR 506

LYPD6B sgRNA CRISPR Lentivector set (Human)

K1247601 3 x 1.0 ug
EUR 339

Lypd6b sgRNA CRISPR Lentivector set (Mouse)

K4043501 3 x 1.0 ug
EUR 339

Lypd6b sgRNA CRISPR Lentivector set (Rat)

K6635101 3 x 1.0 ug
EUR 339

LYPD6B sgRNA CRISPR Lentivector (Human) (Target 1)

K1247602 1.0 ug DNA
EUR 154

LYPD6B sgRNA CRISPR Lentivector (Human) (Target 2)

K1247603 1.0 ug DNA
EUR 154

LYPD6B sgRNA CRISPR Lentivector (Human) (Target 3)

K1247604 1.0 ug DNA
EUR 154

Lypd6b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4043502 1.0 ug DNA
EUR 154

Lypd6b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4043503 1.0 ug DNA
EUR 154

Lypd6b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4043504 1.0 ug DNA
EUR 154

Lypd6b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6635102 1.0 ug DNA
EUR 154

Lypd6b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6635103 1.0 ug DNA
EUR 154

Lypd6b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6635104 1.0 ug DNA
EUR 154

LYPD6B Protein Vector (Rat) (pPB-C-His)

PV280566 500 ng
EUR 603

LYPD6B Protein Vector (Rat) (pPB-N-His)

PV280567 500 ng
EUR 603

LYPD6B Protein Vector (Rat) (pPM-C-HA)

PV280568 500 ng
EUR 603

LYPD6B Protein Vector (Rat) (pPM-C-His)

PV280569 500 ng
EUR 603

LYPD6B Protein Vector (Human) (pPB-C-His)

PV024633 500 ng
EUR 329

LYPD6B Protein Vector (Human) (pPB-N-His)

PV024634 500 ng
EUR 329

LYPD6B Protein Vector (Human) (pPM-C-HA)

PV024635 500 ng
EUR 329

LYPD6B Protein Vector (Human) (pPM-C-His)

PV024636 500 ng
EUR 329

LYPD6B Protein Vector (Mouse) (pPB-C-His)

PV198370 500 ng
EUR 603

LYPD6B Protein Vector (Mouse) (pPB-N-His)

PV198371 500 ng
EUR 603

LYPD6B Protein Vector (Mouse) (pPM-C-HA)

PV198372 500 ng
EUR 603

LYPD6B Protein Vector (Mouse) (pPM-C-His)

PV198373 500 ng
EUR 603

Lypd6b 3'UTR GFP Stable Cell Line

TU162744 1.0 ml Ask for price

Lypd6b 3'UTR Luciferase Stable Cell Line

TU212714 1.0 ml Ask for price

LYPD6B 3'UTR Luciferase Stable Cell Line

TU012795 1.0 ml
EUR 1394

Lypd6b 3'UTR Luciferase Stable Cell Line

TU112744 1.0 ml Ask for price

LYPD6B 3'UTR GFP Stable Cell Line

TU062795 1.0 ml
EUR 1394

Lypd6b 3'UTR GFP Stable Cell Line

TU262714 1.0 ml Ask for price

Ly6/PLAUR Domain-Containing Protein 6B (LYPD6B) Antibody

abx036535-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly6/PLAUR Domain-Containing Protein 6B (LYPD6B) Antibody

abx025521-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

LYPD6B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV621625 1.0 ug DNA
EUR 514

LYPD6B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV621629 1.0 ug DNA
EUR 514

LYPD6B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV621630 1.0 ug DNA
EUR 514

Goat Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E06L0121-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E06L0121-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E06L0121-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E02L0121-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E02L0121-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E02L0121-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E01L0121-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E01L0121-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E01L0121-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E03L0121-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E03L0121-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E03L0121-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E04L0121-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E04L0121-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E04L0121-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E08L0121-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E08L0121-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E08L0121-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E07L0121-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E07L0121-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E07L0121-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E09L0121-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E09L0121-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E09L0121-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ly6/PLAUR domain- containing protein 6B, Lypd6b ELISA KIT

ELI-37428m 96 Tests
EUR 865

Human Ly6/PLAUR domain- containing protein 6B, LYPD6B ELISA KIT

ELI-38072h 96 Tests
EUR 824

LYPD6B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1247605 3 x 1.0 ug
EUR 376

Lypd6b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4043505 3 x 1.0 ug
EUR 376

Lypd6b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6635105 3 x 1.0 ug
EUR 376

Guinea pig Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E05L0121-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E05L0121-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ly6/PLAUR domain containing protein 6B(LYPD6B) ELISA kit

E05L0121-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Ly6/PLAUR domain containing protein 6B(LYPD6B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

LYPD6B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1247606 1.0 ug DNA
EUR 167

LYPD6B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1247607 1.0 ug DNA
EUR 167

LYPD6B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1247608 1.0 ug DNA
EUR 167

Lypd6b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4043506 1.0 ug DNA
EUR 167

Lypd6b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4043507 1.0 ug DNA
EUR 167

Lypd6b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4043508 1.0 ug DNA
EUR 167

Lypd6b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6635106 1.0 ug DNA
EUR 167

Lypd6b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6635107 1.0 ug DNA
EUR 167

Lypd6b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6635108 1.0 ug DNA
EUR 167

LYPD6B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV621626 1.0 ug DNA
EUR 514

LYPD6B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV621627 1.0 ug DNA
EUR 572

LYPD6B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV621628 1.0 ug DNA
EUR 572