Beopenlab

FBXW11 antibody
70R-2795	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FBXW11 antibody raised against the N terminal of FBXW11

FBXW11 antibody
70R-2812	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FBXW11 antibody raised against the N terminal of FBXW11

FBXW11 Antibody
35405-100ul	SAB	100ul	EUR 390

FBXW11 Antibody
1-CSB-PA891721ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FBXW11. Recognizes FBXW11 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

FBXW11 Antibody
DF13009	Affbiotech	200ul	EUR 304
Description: FBXW11 Antibody detects endogenous levels of FBXW11.

FBXW11 Antibody
1-CSB-PA008521GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FBXW11. Recognizes FBXW11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FBXW11 siRNA
20-abx916659	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FBXW11 siRNA
20-abx916660	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FBXW11 Polyclonal Antibody
31330-100ul	SAB	100ul	EUR 252

FBXW11 Polyclonal Antibody
31330-50ul	SAB	50ul	EUR 187

FBXW11 Blocking Peptide
33R-2627	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXW11 antibody, catalog no. 70R-2812

FBXW11 Blocking Peptide
33R-1744	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXW11 antibody, catalog no. 70R-2795

FBXW11 cloning plasmid
CSB-CL891721HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1590 Sequence: atggagcccgactcggtgattgaggacaagaccatcgagctcatgaacacttcagttatggaagatcaaaatgaagatgagtccccaaagaaaaatactctttggcagataagtaatggaacatcatctgtgatcgtctccagaaagaggccatcagaaggaaactatcaaaaag Show more
Description: A cloning plasmid for the FBXW11 gene.

FBXW11 Blocking Peptide
DF13009-BP	Affbiotech	1mg	EUR 195

FBXW11 Rabbit pAb
A7784-100ul	Abclonal	100 ul	EUR 308

FBXW11 Rabbit pAb
A7784-200ul	Abclonal	200 ul	EUR 459

FBXW11 Rabbit pAb
A7784-20ul	Abclonal	20 ul	EUR 183

FBXW11 Rabbit pAb
A7784-50ul	Abclonal	50 ul	EUR 223

anti- FBXW11 antibody
FNab03052	FN Test	100µg	EUR 505.25
Immunogen: F-box and WD repeat domain containing 11 Uniprot ID: Q9UKB1 Gene ID: 23291 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against FBXW11

Anti-FBXW11 antibody
PAab03052	Lifescience Market	100 ug	EUR 355

Anti-FBXW11 antibody
STJ110094	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons.

FBXW11 ELISA KIT|Human
EF009593	Lifescience Market	96 Tests	EUR 689

FBXW11 Polyclonal Conjugated Antibody
C31330	SAB	100ul	EUR 397

Human FBXW11 shRNA Plasmid
20-abx958155	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse FBXW11 shRNA Plasmid
20-abx979585	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FBXW11 Recombinant Protein (Human)
RP011956	ABM	100 ug	Ask for price

FBXW11 Recombinant Protein (Rat)
RP201068	ABM	100 ug	Ask for price

FBXW11 Recombinant Protein (Mouse)
RP134093	ABM	100 ug	Ask for price

Fbxw11 ORF Vector (Rat) (pORF)
ORF067024	ABM	1.0 ug DNA	EUR 506

FBXW11 ORF Vector (Human) (pORF)
ORF003986	ABM	1.0 ug DNA	EUR 95

Fbxw11 ORF Vector (Mouse) (pORF)
ORF044699	ABM	1.0 ug DNA	EUR 506

Fbxw11 sgRNA CRISPR Lentivector set (Mouse)
K4923101	ABM	3 x 1.0 ug	EUR 339

Fbxw11 sgRNA CRISPR Lentivector set (Rat)
K6621901	ABM	3 x 1.0 ug	EUR 339

FBXW11 sgRNA CRISPR Lentivector set (Human)
K0768101	ABM	3 x 1.0 ug	EUR 339

Fbxw11 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4923102	ABM	1.0 ug DNA	EUR 154

Fbxw11 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4923103	ABM	1.0 ug DNA	EUR 154

Fbxw11 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4923104	ABM	1.0 ug DNA	EUR 154

Fbxw11 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6621902	ABM	1.0 ug DNA	EUR 154

Fbxw11 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6621903	ABM	1.0 ug DNA	EUR 154

Fbxw11 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6621904	ABM	1.0 ug DNA	EUR 154

FBXW11 sgRNA CRISPR Lentivector (Human) (Target 1)
K0768102	ABM	1.0 ug DNA	EUR 154

FBXW11 sgRNA CRISPR Lentivector (Human) (Target 2)
K0768103	ABM	1.0 ug DNA	EUR 154

FBXW11 sgRNA CRISPR Lentivector (Human) (Target 3)
K0768104	ABM	1.0 ug DNA	EUR 154

FBXW11 Protein Vector (Mouse) (pPB-C-His)
PV178794	ABM	500 ng	EUR 603

FBXW11 Protein Vector (Mouse) (pPB-N-His)
PV178795	ABM	500 ng	EUR 603

FBXW11 Protein Vector (Mouse) (pPM-C-HA)
PV178796	ABM	500 ng	EUR 603

FBXW11 Protein Vector (Mouse) (pPM-C-His)
PV178797	ABM	500 ng	EUR 603

FBXW11 Protein Vector (Rat) (pPB-C-His)
PV268094	ABM	500 ng	EUR 603

FBXW11 Protein Vector (Rat) (pPB-N-His)
PV268095	ABM	500 ng	EUR 603

FBXW11 Protein Vector (Rat) (pPM-C-HA)
PV268096	ABM	500 ng	EUR 603

FBXW11 Protein Vector (Rat) (pPM-C-His)
PV268097	ABM	500 ng	EUR 603

FBXW11 Protein Vector (Human) (pPB-C-His)
PV015941	ABM	500 ng	EUR 329

FBXW11 Protein Vector (Human) (pPB-N-His)
PV015942	ABM	500 ng	EUR 329

FBXW11 Protein Vector (Human) (pPM-C-HA)
PV015943	ABM	500 ng	EUR 329

FBXW11 Protein Vector (Human) (pPM-C-His)
PV015944	ABM	500 ng	EUR 329

Fbxw11 3'UTR GFP Stable Cell Line
TU156447	ABM	1.0 ml	Ask for price

Fbxw11 3'UTR Luciferase Stable Cell Line
TU106447	ABM	1.0 ml	Ask for price

Fbxw11 3'UTR Luciferase Stable Cell Line
TU204527	ABM	1.0 ml	Ask for price

Fbxw11 3'UTR GFP Stable Cell Line
TU254527	ABM	1.0 ml	Ask for price

FBXW11 3'UTR GFP Stable Cell Line
TU057818	ABM	1.0 ml	EUR 1521

FBXW11 3'UTR Luciferase Stable Cell Line
TU007818	ABM	1.0 ml	EUR 1521

FBXW11 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV621163	ABM	1.0 ug DNA	EUR 682

FBXW11 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV621167	ABM	1.0 ug DNA	EUR 682

FBXW11 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV621168	ABM	1.0 ug DNA	EUR 682

F-Box And WD Repeat Domain Containing 11 (FBXW11) Antibody
20-abx007164	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 11 (FBXW11) Antibody
abx026152-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 11 (FBXW11) Antibody
abx026152-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 11 (FBXW11) Antibody
20-abx112491	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 11 (FBXW11) Antibody
abx036648-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 11 (FBXW11) Antibody
abx036649-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.