FBXW10 Antibody

1-CSB-PA726395LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW10. Recognizes FBXW10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FBXW10 antibody

70R-3250 50 ug
EUR 467
Description: Rabbit polyclonal FBXW10 antibody raised against the N terminal of FBXW10

FBXW10 antibody

70R-3251 50 ug
EUR 467
Description: Rabbit polyclonal FBXW10 antibody raised against the middle region of FBXW10

FBXW10 siRNA

20-abx916658
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXW10 Blocking Peptide

33R-7996 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXW10 antibody, catalog no. 70R-3251

FBXW10 Blocking Peptide

33R-8670 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXW10 antibody, catalog no. 70R-3250

Fbxw10 Antibody (HRP)

20-abx319288
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fbxw10 Antibody (FITC)

20-abx319289
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fbxw10 Antibody (Biotin)

20-abx319290
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FBXW10 Antibody (HRP)

20-abx307642
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FBXW10 Antibody (FITC)

20-abx307643
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FBXW10 Antibody (Biotin)

20-abx307644
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FBXW10 cloning plasmid

CSB-CL726395HU-10ug 10ug
EUR 1172
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3186
  • Sequence: atggaaaacctggaatcaaggctcaagaatgccccctattttcgttgtgagaagggaaccgattccatccctctatgccggaagtgtgagacgtgtgtcttagcctggaagatcttctctaccaaagagtggttctgcaggatcaatgacatatcacagaggaggtttctagttg
  • Show more
Description: A cloning plasmid for the FBXW10 gene.

FBXW10 Polyclonal Antibody

A59106 100 µg
EUR 570.55
Description: Ask the seller for details

Fbxw10 Antibody, HRP conjugated

1-CSB-PA725549LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fbxw10. Recognizes Fbxw10 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Fbxw10 Antibody, FITC conjugated

1-CSB-PA725549LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fbxw10. Recognizes Fbxw10 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Fbxw10 Antibody, Biotin conjugated

1-CSB-PA725549LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fbxw10. Recognizes Fbxw10 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

FBXW10 Antibody, HRP conjugated

1-CSB-PA726395LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW10. Recognizes FBXW10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FBXW10 Antibody, FITC conjugated

1-CSB-PA726395LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW10. Recognizes FBXW10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FBXW10 Antibody, Biotin conjugated

1-CSB-PA726395LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW10. Recognizes FBXW10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human FBXW10 shRNA Plasmid

20-abx957144
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXW10 Polyclonal Antibody, Biotin Conjugated

A59107 100 µg
EUR 570.55
Description: The best epigenetics products

FBXW10 Polyclonal Antibody, FITC Conjugated

A59108 100 µg
EUR 570.55
Description: kits suitable for this type of research

FBXW10 Polyclonal Antibody, HRP Conjugated

A59109 100 µg
EUR 570.55
Description: fast delivery possible

FBXW10 ORF Vector (Human) (pORF)

ORF003985 1.0 ug DNA
EUR 95

Fbxw10 ORF Vector (Mouse) (pORF)

ORF044698 1.0 ug DNA
EUR 506

FBXW10 sgRNA CRISPR Lentivector set (Human)

K0767901 3 x 1.0 ug
EUR 339

Fbxw10 sgRNA CRISPR Lentivector set (Mouse)

K3573701 3 x 1.0 ug
EUR 339

FBXW10 sgRNA CRISPR Lentivector (Human) (Target 1)

K0767902 1.0 ug DNA
EUR 154

FBXW10 sgRNA CRISPR Lentivector (Human) (Target 2)

K0767903 1.0 ug DNA
EUR 154

FBXW10 sgRNA CRISPR Lentivector (Human) (Target 3)

K0767904 1.0 ug DNA
EUR 154

Fbxw10 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3573702 1.0 ug DNA
EUR 154

Fbxw10 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3573703 1.0 ug DNA
EUR 154

Fbxw10 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3573704 1.0 ug DNA
EUR 154

FBXW10 Protein Vector (Mouse) (pPB-C-His)

PV178790 500 ng
EUR 1065

FBXW10 Protein Vector (Mouse) (pPB-N-His)

PV178791 500 ng
EUR 1065

FBXW10 Protein Vector (Mouse) (pPM-C-HA)

PV178792 500 ng
EUR 1065

FBXW10 Protein Vector (Mouse) (pPM-C-His)

PV178793 500 ng
EUR 1065

FBXW10 Protein Vector (Human) (pPB-C-His)

PV015937 500 ng
EUR 329

FBXW10 Protein Vector (Human) (pPB-N-His)

PV015938 500 ng
EUR 329

FBXW10 Protein Vector (Human) (pPM-C-HA)

PV015939 500 ng
EUR 329

FBXW10 Protein Vector (Human) (pPM-C-His)

PV015940 500 ng
EUR 329

Fbxw10 3'UTR GFP Stable Cell Line

TU156446 1.0 ml Ask for price

Fbxw10 3'UTR Luciferase Stable Cell Line

TU106446 1.0 ml Ask for price

Fbxw10 3'UTR Luciferase Stable Cell Line

TU204526 1.0 ml Ask for price

Fbxw10 3'UTR GFP Stable Cell Line

TU254526 1.0 ml Ask for price

FBXW10 3'UTR GFP Stable Cell Line

TU057816 1.0 ml
EUR 1394

FBXW10 3'UTR Luciferase Stable Cell Line

TU007816 1.0 ml
EUR 1394

FBXW10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791635 1.0 ug DNA
EUR 316

FBXW10 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791636 1.0 ug DNA
EUR 316

Mouse F-box/WD repeat-containing protein 10 (Fbxw10)

1-CSB-EP725549MO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse F-box/WD repeat-containing protein 10(Fbxw10),partial expressed in E.coli

F-Box/WD Repeat-Containing Protein 10 (FBXW10) Antibody

abx036681-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

F-Box/WD Repeat-Containing Protein 10 (FBXW10) Antibody

20-abx319287
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

F-Box/WD Repeat-Containing Protein 10 (FBXW10) Antibody

20-abx301425
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FBXW10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0767905 3 x 1.0 ug
EUR 376

Fbxw10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3573705 3 x 1.0 ug
EUR 376

Rat F box/WD repeat containing protein 10(FBXW10) ELISA kit

E02F0331-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box/WD repeat containing protein 10(FBXW10) ELISA kit

E02F0331-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box/WD repeat containing protein 10(FBXW10) ELISA kit

E02F0331-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 10(FBXW10) ELISA kit

E03F0331-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 10(FBXW10) ELISA kit

E03F0331-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 10(FBXW10) ELISA kit

E03F0331-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 10(FBXW10) ELISA kit

E04F0331-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 10(FBXW10) ELISA kit

E04F0331-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 10(FBXW10) ELISA kit

E04F0331-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 10(FBXW10) ELISA kit

E01F0331-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 10(FBXW10) ELISA kit

E01F0331-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 10(FBXW10) ELISA kit

E01F0331-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 10(FBXW10) ELISA kit

E06F0331-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 10(FBXW10) ELISA kit

E06F0331-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 10(FBXW10) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.