
CA057-001 1g
EUR 196


AT023 1mg
EUR 1790


E1KS1322 100mg
EUR 247


HY-14648 10mM/1mL
EUR 113


GP8543-1G 1 g
EUR 90


GP8543-250MG 250 mg
EUR 54


GP8543-5G 5 g
EUR 166


  • EUR 244.00
  • EUR 509.00
  • 1 g
  • 5 g
  • Shipped within 5-12 working days.


  • EUR 217.00
  • EUR 384.00
  • 100 mg
  • 1 g
  • Shipped within 5-10 working days.


abx183974-5g 5 g
EUR 370
  • Shipped within 1-2 weeks.


EUR 659


EUR 191


SB0485 100g
EUR 67.4
  • Product category: Biochemicals/Detergents/Surfactants

Dexamethasone acetate

B1926-100 100 mg
EUR 166
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.

Dexamethasone acetate

B1926-5 5 mg
EUR 108
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.

Dexamethasone acetate

B1926-5.1 10 mM (in 1mL DMSO)
EUR 142
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.

Dexamethasone palmitate

HY-128922 50mg
EUR 245

Dexamethasone (acetate)

HY-14648A 5g
EUR 199


80-1142 500 ul
EUR 417
Description: Dexamethasone 21 Conjugate for use in immunoassays

Dexamethasone (DHAP)

A2324-100 100 mg
EUR 166
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)

A2324-1000 1 g
EUR 139
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)

A2324-5 5 mg
EUR 108
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)

A2324-5.1 10 mM (in 1mL DMSO)
EUR 154
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)

A2324-5000 5 g
EUR 293
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Sds/ Rat Sds ELISA Kit

ELI-15462r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SDS antibody

70R-3627 50 ug
EUR 467
Description: Rabbit polyclonal SDS antibody raised against the N terminal of SDS

SDS antibody

70R-3762 50 ug
EUR 467
Description: Rabbit polyclonal SDS antibody raised against the middle region of SDS

SDS Solution

EUR 137

SDS antibody

10R-5712 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

10R-5718 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

10R-5720 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

10% SDS

TG4060 1ml
EUR 134


YF-PA17352 50 ug
EUR 363
Description: Mouse polyclonal to SDS

Dexamethasone Sodium Phosphate

B1588-100 100 mg
EUR 166
Description: Dexamethasone is an interleukin receptor inhibitor and also suppresses COX-2.

Dexamethasone Sodium Phosphate

B1588-5 5 mg
EUR 108
Description: Dexamethasone is an interleukin receptor inhibitor and also suppresses COX-2.

Dexamethasone phosphate disodium

HY-B1829A 10mM/1mL
EUR 113

Dexamethasone 9,11-epoxide

HY-N0348 10mM/1mL
EUR 126

Dexamethasone phosphate sodium

  • EUR 342.00
  • EUR 648.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.

Dexamethasone Hemisuccinate Antibody

abx411076-1ml 1 ml
EUR 439
  • Shipped within 1 week.

Dexamethasone (10 mM)

EUR 153

Dexamethasone 21 antibody

20-1436 100 ul
EUR 657
Description: Sheep polyclonal Dexamethasone 21 antibody

Dexamethasone(21) [HRP]

DAG1086 0.5ml
EUR 714

Dexamethasone phosphate disodium

B2744-1G 1 g
EUR 115

Dexamethasone phosphate disodium

B2744-5G 5 g
EUR 277

dAbs scaffold protein anti-Human B5R

SDS-L073 1 mg
EUR 4496
Description: Scaffold protein

TT-SDS (Tris-Tricine-SDS buffer) Premix powder

TD8135 1PK, 10L
EUR 76.1
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4

UA0030 500ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution

A0030 4L
EUR 94.8
  • Product category: Biochemicals/Biological Buffers/Common Buffers

SDS cloning plasmid

CSB-CL020926HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca
  • Show more
Description: A cloning plasmid for the SDS gene.

SDS Rabbit pAb

A12898-100ul 100 ul
EUR 308

SDS Rabbit pAb

A12898-200ul 200 ul
EUR 459

SDS Rabbit pAb

A12898-20ul 20 ul
EUR 183

SDS Rabbit pAb

A12898-50ul 50 ul
EUR 223

SDS Blocking Peptide

33R-4446 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide

33R-1011 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS Polyclonal Antibody

27842-100ul 100ul
EUR 252

SDS Polyclonal Antibody

27842-50ul 50ul
EUR 187

100G SDS Ultrapure

NAT1072 100G
EUR 93

1KG SDS Ultrapure

NAT1074 1KG
EUR 306

101Bio SDS-Remover


10% SDS Solution

S0792-050 500ml
EUR 93

10% SDS Solution

S0792-100 2X500ml
EUR 122

20% SDS Solution

S0793-050 500ml
EUR 120

20% SDS Solution

S0793-100 2X500ml
EUR 166

SurfactAway™ SDS

SA645-30 30 mL
EUR 379

SurfactAway™ SDS

SA646-250 250 mL
EUR 1389

Anti-SDS antibody

STJ114764 100 µl
EUR 277
Description: This gene encodes one of three enzymes that are involved in metabolizing serine and glycine. L-serine dehydratase converts L-serine to pyruvate and ammonia and requires pyridoxal phosphate as a cofactor. The encoded protein can also metabolize threonine to NH4+ and 2-ketobutyrate. The encoded protein is found predominantly in the liver.