Beopenlab

CHCHD4 antibody
70R-16381	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CHCHD4 antibody

CHCHD4 antibody
70R-2526	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CHCHD4 antibody raised against the N terminal of CHCHD4

CHCHD4 Antibody
1-CSB-PA850802HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHCHD4. Recognizes CHCHD4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CHCHD4 Antibody
1-CSB-PA005319GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CHCHD4. Recognizes CHCHD4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

CHCHD4 Antibody
DF12364	Affbiotech	200ul	EUR 304
Description: CHCHD4 antibody detects endogenous levels of CHCHD4.

CHCHD4 siRNA
20-abx901030	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CHCHD4 siRNA
20-abx911649	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CHCHD4 siRNA
20-abx911650	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CHCHD4 Polyclonal Antibody
27915-100ul	SAB	100ul	EUR 252

CHCHD4 Polyclonal Antibody
27915-50ul	SAB	50ul	EUR 187

CHCHD4 Rabbit pAb
A13139-100ul	Abclonal	100 ul	EUR 308

CHCHD4 Rabbit pAb
A13139-200ul	Abclonal	200 ul	EUR 459

CHCHD4 Rabbit pAb
A13139-20ul	Abclonal	20 ul	EUR 183

CHCHD4 Rabbit pAb
A13139-50ul	Abclonal	50 ul	EUR 223

CHCHD4 Blocking Peptide
33R-6527	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHCHD4 antibody, catalog no. 70R-2526

CHCHD4 Blocking Peptide
DF12364-BP	Affbiotech	1mg	EUR 195

CHCHD4 cloning plasmid
CSB-CL850802HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 429 Sequence: atgtcctattgccggcaggaagggaaggatcgaatcatatttgtaaccaaagaagatcatgaaactccaagcagtgcagaattggtggctgatgaccccaacgatccatacgaggagcatggattgatactgccaaatggaaacattaactggaactgcccatgccttgggggaat Show more
Description: A cloning plasmid for the CHCHD4 gene.

CHCHD4 Rabbit pAb
A9453-100ul	Abclonal	100 ul	EUR 308

CHCHD4 Rabbit pAb
A9453-200ul	Abclonal	200 ul	EUR 459

CHCHD4 Rabbit pAb
A9453-20ul	Abclonal	20 ul	Ask for price

CHCHD4 Rabbit pAb
A9453-50ul	Abclonal	50 ul	Ask for price

CHCHD4 Polyclonal Antibody
A56314	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

anti- CHCHD4 antibody
FNab01637	FN Test	100µg	EUR 505.25
Immunogen: coiled-coil-helix-coiled-coil-helix domain containing 4 Uniprot ID: Q8N4Q1 Gene ID: 131474 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against CHCHD4

Anti-CHCHD4 antibody
PAab01637	Lifescience Market	100 ug	EUR 355

Anti-CHCHD4 antibody
STJ111705	St John's Laboratory	100 µl	EUR 277

Anti-CHCHD4 antibody
STJ115105	St John's Laboratory	100 µl	EUR 277

CHCHD4 Antibody, HRP conjugated
1-CSB-PA850802HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHCHD4. Recognizes CHCHD4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CHCHD4 Antibody, FITC conjugated
1-CSB-PA850802HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHCHD4. Recognizes CHCHD4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CHCHD4 Antibody, Biotin conjugated
1-CSB-PA850802HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHCHD4. Recognizes CHCHD4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human CHCHD4 ELISA KIT
ELI-14027h	Lifescience Market	96 Tests	EUR 824

Bovine CHCHD4 ELISA KIT
ELI-23464b	Lifescience Market	96 Tests	EUR 928

Mouse Chchd4 ELISA KIT
ELI-23465m	Lifescience Market	96 Tests	EUR 865

CHCHD4 ELISA KIT|Human
EF008627	Lifescience Market	96 Tests	EUR 689

Rat CHCHD4 shRNA Plasmid
20-abx989723	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CHCHD4 shRNA Plasmid
20-abx977702	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CHCHD4 shRNA Plasmid
20-abx965064	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CHCHD4 Polyclonal Conjugated Antibody
C27915	SAB	100ul	EUR 397

CHCHD4 Recombinant Protein (Human)
RP006958	ABM	100 ug	Ask for price

CHCHD4 Recombinant Protein (Rat)
RP194783	ABM	100 ug	Ask for price

CHCHD4 Recombinant Protein (Mouse)
RP123818	ABM	100 ug	Ask for price

CHCHD4 Polyclonal Antibody, HRP Conjugated
A56315	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

CHCHD4 Polyclonal Antibody, FITC Conjugated
A56316	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

CHCHD4 Polyclonal Antibody, Biotin Conjugated
A56317	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Chchd4 ORF Vector (Rat) (pORF)
ORF064929	ABM	1.0 ug DNA	EUR 506

CHCHD4 ORF Vector (Human) (pORF)
ORF002320	ABM	1.0 ug DNA	EUR 95

Chchd4 ORF Vector (Mouse) (pORF)
ORF041274	ABM	1.0 ug DNA	EUR 506

CHCHD4 sgRNA CRISPR Lentivector set (Human)
K0441901	ABM	3 x 1.0 ug	EUR 339

Chchd4 sgRNA CRISPR Lentivector set (Rat)
K7300001	ABM	3 x 1.0 ug	EUR 339

Chchd4 sgRNA CRISPR Lentivector set (Mouse)
K4735601	ABM	3 x 1.0 ug	EUR 339

CHCHD4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0441902	ABM	1.0 ug DNA	EUR 154

CHCHD4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0441903	ABM	1.0 ug DNA	EUR 154

CHCHD4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0441904	ABM	1.0 ug DNA	EUR 154

Chchd4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7300002	ABM	1.0 ug DNA	EUR 154

Chchd4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7300003	ABM	1.0 ug DNA	EUR 154

Chchd4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7300004	ABM	1.0 ug DNA	EUR 154

Chchd4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4735602	ABM	1.0 ug DNA	EUR 154

Chchd4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4735603	ABM	1.0 ug DNA	EUR 154

Chchd4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4735604	ABM	1.0 ug DNA	EUR 154

CHCHD4 Protein Vector (Mouse) (pPB-C-His)
PV165094	ABM	500 ng	EUR 603

CHCHD4 Protein Vector (Mouse) (pPB-N-His)
PV165095	ABM	500 ng	EUR 603

CHCHD4 Protein Vector (Mouse) (pPM-C-HA)
PV165096	ABM	500 ng	EUR 603

CHCHD4 Protein Vector (Mouse) (pPM-C-His)
PV165097	ABM	500 ng	EUR 603

CHCHD4 Protein Vector (Rat) (pPB-C-His)
PV259714	ABM	500 ng	EUR 603

CHCHD4 Protein Vector (Rat) (pPB-N-His)
PV259715	ABM	500 ng	EUR 603

CHCHD4 Protein Vector (Rat) (pPM-C-HA)
PV259716	ABM	500 ng	EUR 603

CHCHD4 Protein Vector (Rat) (pPM-C-His)
PV259717	ABM	500 ng	EUR 603

CHCHD4 Protein Vector (Human) (pPB-C-His)
PV009277	ABM	500 ng	EUR 329

CHCHD4 Protein Vector (Human) (pPB-N-His)
PV009278	ABM	500 ng	EUR 329

CHCHD4 Protein Vector (Human) (pPM-C-HA)
PV009279	ABM	500 ng	EUR 329

CHCHD4 Protein Vector (Human) (pPM-C-His)
PV009280	ABM	500 ng	EUR 329

Chchd4 3'UTR GFP Stable Cell Line
TU153807	ABM	1.0 ml	Ask for price

Chchd4 3'UTR Luciferase Stable Cell Line
TU103807	ABM	1.0 ml	Ask for price

Chchd4 3'UTR Luciferase Stable Cell Line
TU202260	ABM	1.0 ml	Ask for price

Chchd4 3'UTR GFP Stable Cell Line
TU252260	ABM	1.0 ml	Ask for price

CHCHD4 3'UTR GFP Stable Cell Line
TU054320	ABM	1.0 ml	EUR 1394

CHCHD4 3'UTR Luciferase Stable Cell Line
TU004320	ABM	1.0 ml	EUR 1394

CHCHD4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV685717	ABM	1.0 ug DNA	EUR 514

CHCHD4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV685721	ABM	1.0 ug DNA	EUR 514

CHCHD4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV685722	ABM	1.0 ug DNA	EUR 514

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-100ug
QP7968-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-10ug
QP7968-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-1mg
QP7968-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-200ug
QP7968-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-500ug
QP7968-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human CHCHD4 Protein, His-SUMO, E.coli-50ug
QP7968-ec-50ug	EnQuireBio	50ug	EUR 263

Human Mitochondrial intermembrane space import and assembly protein 40 (CHCHD4)
1-CSB-EP850802HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 32 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Mitochondrial intermembrane space import and assembly protein 40(CHCHD4) expressed in E.coli

CHCHD4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0441905	ABM	3 x 1.0 ug	EUR 376

Chchd4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7300005	ABM	3 x 1.0 ug	EUR 376

Chchd4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4735605	ABM	3 x 1.0 ug	EUR 376

Coiled-Coil-Helix-Coiled-Coil-Helix Domain Containing 4 (Chchd4) Antibody
20-abx111742	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.