CDC25A

CDC25A Antibody
AF6252 200ul
EUR 304
Description: CDC25A Antibody detects endogenous levels of total CDC25A.

CDC25A siRNA
20-abx900932
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC25A Antibody
ABF6252 100 ug
EUR 438

CDC25A siRNA
20-abx911124
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC25A siRNA
20-abx911125
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDC25A antibody
70R-49512 100 ul
EUR 287
Description: Purified Polyclonal CDC25A antibody

CDC25A antibody
70R-49513 100 ul
EUR 287
Description: Purified Polyclonal CDC25A antibody

cdc25A antibody
70R-36265 100 ug
EUR 327
Description: Rabbit polyclonal cdc25A antibody

CDC25A antibody
70R-37599 100 ug
EUR 273
Description: Rabbit Polyclonal CDC25A antibody

CDC25A antibody
70R-33494 100 ug
EUR 327
Description: Rabbit polyclonal CDC25A antibody

CDC25A Antibody
ABD6307 100 ug
EUR 438

CDC25A Antibody
35386-100ul 100ul
EUR 390

CDC25A antibody
10R-8626 100 ul
EUR 393
Description: Mouse monoclonal CDC25A antibody

CDC25A Antibody
32202-100ul 100ul
EUR 252

cdc25A antibody
20R-1992 50 ug
EUR 281
Description: Rabbit polyclonal cdc25A antibody

cdc25A antibody
20R-2333 50 ug
EUR 281
Description: Rabbit polyclonal cdc25A antibody

CDC25A antibody
70R-14083 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal CDC25A antibody

CDC25A antibody
70R-10483 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CDC25A antibody

CDC25A Antibody
DF6307 200ul
EUR 304
Description: CDC25A Antibody detects endogenous levels of total CDC25A.

CDC25A Antibody
CSB-PA004994KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CDC25A Antibody
CSB-PA004994KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CDC25A Antibody
1-CSB-PA244825
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

CDC25A Antibody
1-CSB-PA281759
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

CDC25A Antibody
1-CSB-PA206399
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CDC25A Antibody
1-CSB-PA12709A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CDC25A Antibody
1-CSB-PA080095
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CDC25A Antibody
1-CSB-PA080096
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CDC25A Antibody
1-CSB-PA080097
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

CDC25A Antibody
1-CSB-PA080098
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDC25A. Recognizes CDC25A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

anti-CDC25A
YF-PA10833 50 ug
EUR 363
Description: Mouse polyclonal to CDC25A

anti-CDC25A
YF-PA10834 100 ul
EUR 403
Description: Rabbit polyclonal to CDC25A

anti-CDC25A
YF-PA10835 100 ug
EUR 403
Description: Rabbit polyclonal to CDC25A

CDC25A Blocking Peptide
AF6252-BP 1mg
EUR 195

CDC25A cloning plasmid
CSB-CL004994HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1575
  • Sequence: atggaactgggcccggagcccccgcaccgccgccgcctgctcttcgcctgcagcccccctcccgcgtcgcagcccgtcgtgaaggcgctatttggcgcttcagccgccgggggactgtcgcctgtcaccaacctgaccgtcactatggaccagctgcagggtctgggcagtgatt
  • Show more
Description: A cloning plasmid for the CDC25A gene.

anti- CDC25A antibody
FNab01521 100µg
EUR 548.75
  • Immunogen: cell division cycle 25 homolog A(S. pombe)
  • Uniprot ID: P30304
  • Gene ID: 993
  • Research Area: Cell Division and Proliferation, Metabolism
Description: Antibody raised against CDC25A

Cdc25A Polyclonal Antibody
ES1926-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cdc25A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cdc25A Polyclonal Antibody
ES1926-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cdc25A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cdc25A Polyclonal Antibody
ES8131-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cdc25A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cdc25A Polyclonal Antibody
ES8131-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cdc25A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cdc25A Polyclonal Antibody
ES8132-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cdc25A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cdc25A Polyclonal Antibody
ES8132-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cdc25A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cdc25A Polyclonal Antibody
ES8133-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cdc25A from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Cdc25A Polyclonal Antibody
ES8133-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cdc25A from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Cdc25A Polyclonal Antibody
ES8134-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cdc25A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cdc25A Polyclonal Antibody
ES8134-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cdc25A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDC25A (pS76) Antibody
20-abx119170
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

CDC25A (pT507) Antibody
20-abx119341
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody
20-abx121336
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

CDC25A (pS178) Antibody
20-abx121926
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cdc25A Polyclonal Antibody
ABP57132-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of T507
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of T507

Cdc25A Polyclonal Antibody
ABP57132-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of T507
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of T507

Cdc25A Polyclonal Antibody
ABP57132-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of T507
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of T507

Cdc25A Polyclonal Antibody
ABP57133-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S178
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S178

Cdc25A Polyclonal Antibody
ABP57133-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S178
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S178

Cdc25A Polyclonal Antibody
ABP57133-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S178
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S178

Cdc25A Polyclonal Antibody
ABP57134-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat, Monkey. This Cdc25A antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75

Cdc25A Polyclonal Antibody
ABP57134-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat, Monkey. This Cdc25A antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75

Cdc25A Polyclonal Antibody
ABP57134-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat, Monkey. This Cdc25A antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75

Cdc25A Polyclonal Antibody
ABP57135-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75

Cdc25A Polyclonal Antibody
ABP57135-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75

Cdc25A Polyclonal Antibody
ABP57135-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S75

CDC25A (pS76) Antibody
20-abx000369
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CDC25A Blocking Peptide
20-abx161334
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CDC25A Blocking Peptide
20-abx161335
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CDC25A (pS82) Antibody
abx149119-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Cdc25A Polyclonal Antibody
ABP50927-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124

Cdc25A Polyclonal Antibody
ABP50927-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124

Cdc25A Polyclonal Antibody
ABP50927-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124
  • Applications tips:
Description: A polyclonal antibody for detection of Cdc25A from Human, Mouse, Rat. This Cdc25A antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Cdc25A around the non-phosphorylation site of S124

CDC25A (pS75) Antibody
20-abx009745
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

CDC25A (pS124) Antibody
20-abx009746
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody
abx010530-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pS124) Antibody
abx010531-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pT507) Antibody
abx010532-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pS178) Antibody
abx010534-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody
abx010535-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody
abx010536-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CDC25A (pS124) Antibody
abx031838-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CDC25A (pS124) Antibody
abx031838-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CDC25A (pS278) Antibody
abx031840-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CDC25A (pS278) Antibody
abx031840-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CDC25A (pS293) Antibody
abx031841-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CDC25A (pS293) Antibody
abx031841-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody
abx031842-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CDC25A (pS75) Antibody
abx031842-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CDC25A (pT507) Antibody
abx031843-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CDC25A (pT507) Antibody
abx031843-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cdc25A (pS79) Antibody
abx032018-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cdc25A (pS79) Antibody
abx032018-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CDC25A (pS178) Antibody
abx333343-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

CDC25A (pT507) Antibody
abx333450-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Copyright © 2021 Beopenlab - WordPress Theme : by Sparkle Themes