B3GNT6 siRNA

20-abx908784
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B3GNT6 siRNA

20-abx908785
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-B3GNT6

YF-PA22642 50 ug
EUR 363
Description: Mouse polyclonal to B3GNT6

B3GNT6 Polyclonal Antibody

28788-100ul 100ul
EUR 252

B3GNT6 Polyclonal Antibody

28788-50ul 50ul
EUR 187

B3GNT6 Polyclonal Antibody

28789-100ul 100ul
EUR 252

B3GNT6 Polyclonal Antibody

28789-50ul 50ul
EUR 187

B3GNT6 cloning plasmid

CSB-CL744392HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1155
  • Sequence: ATGGCTTTTCCCTGCCGCAGGTCCCTGACTGCCAAGACTCTGGCCTGCCTCCTGGTGGGCGTGAGTTTCTTAGCACTGCAGCAGTGGTTCCTCCAGGCGCCAAGGTCCCCGCGGGAGGAGAGGTCCCCGCAGGAGGAGACGCCAGAGGGTCCCACCGACGCTCCCGCGGCTGACG
  • Show more
Description: A cloning plasmid for the B3GNT6 gene.

B3GNT6 Rabbit pAb

A14974-100ul 100 ul
EUR 308

B3GNT6 Rabbit pAb

A14974-200ul 200 ul
EUR 459

B3GNT6 Rabbit pAb

A14974-20ul 20 ul
EUR 183

B3GNT6 Rabbit pAb

A14974-50ul 50 ul
EUR 223

B3GNT6 Rabbit pAb

A14975-100ul 100 ul
EUR 308

B3GNT6 Rabbit pAb

A14975-200ul 200 ul
EUR 459

B3GNT6 Rabbit pAb

A14975-20ul 20 ul
EUR 183

B3GNT6 Rabbit pAb

A14975-50ul 50 ul
EUR 223

Anti-B3GNT6 antibody

STJ117173 100 µl
EUR 277
Description: The protein encoded by this gene is a beta-1,3-N-acetylglucosaminyltransferase that adds an N-acetylglucosamine moiety to N-acetylgalactosamine-modified serine or threonine. The encoded enzyme is responsible for creating the core 3 structure of O-glycans, which are important components of mucin-type glycoproteins.

Anti-B3GNT6 antibody

STJ117174 100 µl
EUR 277
Description: The protein encoded by this gene is a beta-1,3-N-acetylglucosaminyltransferase that adds an N-acetylglucosamine moiety to N-acetylgalactosamine-modified serine or threonine. The encoded enzyme is responsible for creating the core 3 structure of O-glycans, which are important components of mucin-type glycoproteins.

B3GNT6 Antibody, HRP conjugated

1-CSB-PA744392LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B3GNT6. Recognizes B3GNT6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

B3GNT6 Antibody, FITC conjugated

1-CSB-PA744392LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B3GNT6. Recognizes B3GNT6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

B3GNT6 Antibody, Biotin conjugated

1-CSB-PA744392LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B3GNT6. Recognizes B3GNT6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal B3GNT6 Antibody (Center)

APR10862G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human B3GNT6 (Center). This antibody is tested and proven to work in the following applications:

Human B3GNT6 ELISA KIT

ELI-23963h 96 Tests
EUR 824

Mouse B3gnt6 ELISA KIT

ELI-23964m 96 Tests
EUR 865

Human B3GNT6 shRNA Plasmid

20-abx966152
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

B3GNT6 Polyclonal Conjugated Antibody

C28788 100ul
EUR 397

B3GNT6 Polyclonal Conjugated Antibody

C28789 100ul
EUR 397

Mouse B3GNT6 shRNA Plasmid

20-abx983149
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

B3GNT6 Recombinant Protein (Human)

RP036886 100 ug Ask for price

B3GNT6 Recombinant Protein (Mouse)

RP118529 100 ug Ask for price

B3GNT6 Recombinant Protein (Rat)

RP191747 100 ug Ask for price

B3GNT6, soluble fragment, Human Recombinant

P1221-5
EUR 240

B3gnt6 ORF Vector (Rat) (pORF)

ORF063917 1.0 ug DNA
EUR 506

B3GNT6 ORF Vector (Human) (pORF)

ORF012296 1.0 ug DNA
EUR 354

B3gnt6 ORF Vector (Mouse) (pORF)

ORF039511 1.0 ug DNA
EUR 506

B3gnt6 sgRNA CRISPR Lentivector set (Rat)

K6101801 3 x 1.0 ug
EUR 339

B3gnt6 sgRNA CRISPR Lentivector set (Mouse)

K3573101 3 x 1.0 ug
EUR 339

B3GNT6 sgRNA CRISPR Lentivector set (Human)

K0164201 3 x 1.0 ug
EUR 339

B3gnt6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6101802 1.0 ug DNA
EUR 154

B3gnt6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6101803 1.0 ug DNA
EUR 154

B3gnt6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6101804 1.0 ug DNA
EUR 154

B3gnt6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3573102 1.0 ug DNA
EUR 154

B3gnt6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3573103 1.0 ug DNA
EUR 154

B3gnt6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3573104 1.0 ug DNA
EUR 154

B3GNT6 sgRNA CRISPR Lentivector (Human) (Target 1)

K0164202 1.0 ug DNA
EUR 154

B3GNT6 sgRNA CRISPR Lentivector (Human) (Target 2)

K0164203 1.0 ug DNA
EUR 154

B3GNT6 sgRNA CRISPR Lentivector (Human) (Target 3)

K0164204 1.0 ug DNA
EUR 154

B3GNT6 Protein Vector (Mouse) (pPB-C-His)

PV158042 500 ng
EUR 603

B3GNT6 Protein Vector (Mouse) (pPB-N-His)

PV158043 500 ng
EUR 603

B3GNT6 Protein Vector (Mouse) (pPM-C-HA)

PV158044 500 ng
EUR 603