  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACTL6A antibody

70R-3160 50 ug
EUR 467
Description: Rabbit polyclonal ACTL6A antibody raised against the N terminal of ACTL6A

ACTL6A Antibody

ABD3066 100 ug
EUR 438

ACTL6A Antibody

49746-100ul 100ul
EUR 333

ACTL6A Antibody

49746-50ul 50ul
EUR 239

ACTL6A Antibody

32821-100ul 100ul
EUR 252

ACTL6A Antibody

EUR 349

ACTL6A Antibody

EUR 146

ACTL6A antibody

70R-15564 50 ul
EUR 435
Description: Rabbit polyclonal ACTL6A antibody

ACTL6A Antibody

DF3066 200ul
EUR 304
Description: ACTL6A Antibody detects endogenous levels of total ACTL6A.

ACTL6A Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ACTL6A. Recognizes ACTL6A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, ChIP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ACTL6A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ACTL6A. Recognizes ACTL6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ACTL6A Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ACTL6A. Recognizes ACTL6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

ACTL6A Antibody

CSB-PA294225-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ACTL6A. Recognizes ACTL6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

ACTL6A Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACTL6A. Recognizes ACTL6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000


PVT18552 2 ug
EUR 231

ACTL6A Conjugated Antibody

C49746 100ul
EUR 397

Polyclonal ACTL6A Antibody

APR14787G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTL6A . This antibody is tested and proven to work in the following applications:

ACTL6A Conjugated Antibody

C32821 100ul
EUR 397

anti- ACTL6A antibody

FNab00118 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IP: 1:200-1:2000
  • Immunogen: actin-like 6A
  • Uniprot ID: O96019
  • Gene ID: 86
  • Research Area: Cell Division and Proliferation, Signal Transduction, Metabolism
Description: Antibody raised against ACTL6A

ACTL6A Polyclonal Antibody

A-2717 100 µl
EUR 483.55
Description: fast delivery possible

ACTL6A Rabbit pAb

A5387-100ul 100 ul
EUR 308

ACTL6A Rabbit pAb

A5387-200ul 200 ul
EUR 459

ACTL6A Rabbit pAb

A5387-20ul 20 ul
EUR 183

ACTL6A Rabbit pAb

A5387-50ul 50 ul
EUR 223

ACTL6A Rabbit pAb

A2220-100ul 100 ul
EUR 308

ACTL6A Rabbit pAb

A2220-200ul 200 ul
EUR 459

ACTL6A Rabbit pAb

A2220-20ul 20 ul Ask for price

ACTL6A Rabbit pAb

A2220-50ul 50 ul Ask for price

ACTL6A Polyclonal Antibody

A68298 100 µl
EUR 483.55
Description: reagents widely cited

ACTL6A Blocking Peptide

33R-9460 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACTL6A antibody, catalog no. 70R-3160

ACTL6A Blocking Peptide

EUR 153

ACTL6A Blocking Peptide

DF3066-BP 1mg
EUR 195

ACTL6A cloning plasmid

CSB-CL001236HU1-10ug 10ug
EUR 471
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1290
  • Sequence: atgagcggcggcgtgtacgggggagatgaagttggagcccttgtttttgacattggatcctatactgtgagagctggttatgctggtgaggactgccccaaggtggattttcctacagctattggtatggtggtagaaagagatgacggaagcacattaatggaaatagatggcg
  • Show more
Description: A cloning plasmid for the ACTL6A gene.

ACTL6A cloning plasmid

CSB-CL001236HU2-10ug 10ug
EUR 471
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1290
  • Sequence: atgagcggcggcgtgtacgggggagatgaagttggagcccttgtttttgacattggatcctatactgtgagagctggttatgctggtgaggactgccccaaggtggattttcctacagctattggtatggtggtagaaagagatgacggaagcacattaatggaaatagatggcg
  • Show more
Description: A cloning plasmid for the ACTL6A gene.

Anti-ACTL6A antibody

PAab00118 100 ug
EUR 355


PVT12564 2 ug
EUR 391

Anti-ACTL6A antibody

STJ27340 100 µl
EUR 277
Description: This gene encodes a family member of actin-related proteins (ARPs), which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a 53 kDa subunit protein of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. Together with beta-actin, it is required for maximal ATPase activity of BRG1, and for the association of the BAF complex with chromatin/matrix. Three transcript variants that encode two different protein isoforms have been described.

Anti-ACTL6A antibody

STJ111132 100 µl
EUR 277
Description: This gene encodes a family member of actin-related proteins (ARPs), which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a 53 kDa subunit protein of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. Together with beta-actin, it is required for maximal ATPase activity of BRG1, and for the association of the BAF complex with chromatin/matrix. Three transcript variants that encode two different protein isoforms have been described.


abx595698-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Polyclonal ACTL6A Antibody (Center)

APR14788G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTL6A (Center). This antibody is tested and proven to work in the following applications:

Mouse ACTL6A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF007593 96 Tests
EUR 689

Human ACTL6A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-ACTL6A Monoclonal Antibody

M05553 100ug
EUR 397
Description: Rabbit Monoclonal ACTL6A Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

ACTL6A Recombinant Protein (Human)

RP000385 100 ug Ask for price

ACTL6A Recombinant Protein (Human)

RP000388 100 ug Ask for price

ACTL6A Recombinant Protein (Rat)

RP189020 100 ug Ask for price

ACTL6A Recombinant Protein (Mouse)

RP114044 100 ug Ask for price

Polyclonal ACTL6A Antibody (N-term)

APR14789G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTL6A (N-term). This antibody is tested and proven to work in the following applications: